Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ717299
Length 803 bp
Fasta Format > whvd15h20
ggtttacgagaacgatgctatcagtacgaggagagcgccatacgaggatt catccggtatattctgggataacgacagtttggcgacgctgttggcaaaa gaactggatgctgatcttcttatcatgcttagtgatgtggagggactcta tagtggtccaccgagcgatcctcaatcaaagattatccacacatacatca atgaaaaacacgggaagctaattaattttggggagaagtctcgtgtggga agaggtggaatgcaagctaaagtggcagctgctgttactgctgcatcaaa gggcgtacctgctgtaattgcaagtggatttgtaacagatagcattatta agattatgcgaggagagaaaattggtacacttttccataatgaagcaaat gtctgggattgttcgaaggaggtgacaacccgtgagatggcagttgctgc aaaagattgttcacggcatctccagaatttgtcatcggaggagcgtaaga agattttgctagatatcgccggtgctctggatgcaaatgtggatttaatt atatccgagaatgaagctgatctagctgcggcacaagattcaggttatga gaaatccttggtggctaggatgaccctgaaggcaggaaagataacaagcc ttgctgaatcgatccgtgcaattgcggacatggaggaccctatctcacat acactgaaaaaaacaggaggttgctaaggatttagttttcgagaagatgt actgcccattgggtgttctcctaattatttttgagtctcgtcctgatgcc ctg
Download
page-top