Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716854
Length 780 bp
Fasta Format > whvd13o11
gcgccctctctcccccgccccctccccccaggaaaccagccatgaagggg gccaaatccaagggcgccgccaaggccgacgccaagttggcggtgaagag caagggggcggagaagccggccgccaaggggaagaagggcaaggccggca aggaccccaacaagcccaagagggcgccatccgccttcttcgtcttcatg ggcgagttccgcgaggagttcaagcagaagaaccccaagaacaagtccgt cgccgccgtcggcaaagcggccggtgagaggtggaagagcttgagcgaat cggaaaaggccccctatgtggccaaggccaacaagctcaagggcgagtac aacaaggccattgctgcctacaacaagggcgagagcgctgctgctgctgc cccaaagaaggctgcggccaaggaggtagaggaggaagatgaggaggaat ctgacaagtccaagtcggagatcaatgacgacgatgacgatgagggcagc gatgaggacgaggacgatgacgagtgaagaagacgcatcttgtcaaggct gctccggcggacaagtcgggagctgctgtgcgagaacggacctgagctgt gtgcggtggtgtcataaggagcctatccatctccactanaattatcccaa gtttcacttcacatcgtgatgttgttttacctttttcctgtcattgtcct gctataacggatancgctccctgttggcgccgccgccggcggggatgccc tantggtggagggtgtatgtcctcttccnc
Download
page-top