Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716744
Length 243 bp
Fasta Format > whvd13h11
actaaggtgccagatgctccacacggacgttgctacttgcctgcacgtag taactactcgtatatgtggtcaataagaaggtaggtgcatgtatgtatgt acgcgtacgtacagattgcacagttatgtttacccaataataccagaact ctgttctgatcgtgtattcaccctgtaagacttctctttcttgcacaata tataatacatgcaactgtcatgcatgttataataaaaaaaaaa
Download
page-top