Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716683
Length 758 bp
Fasta Format > whvd13d20
ctgccttccagagacaatcaagaacgccaggcagctcaaaccaagcaatg tctttggcaccttccatcccttccatcaaggtgaaggtgggacgcatcgc cccgccgcctccgtaccgggcatgcaagtcgttcgccgtgatcaggagct ccaaggccgaggggcccaggagacccacggcgcctccactgtcgccgccc ccgcctatgcctcccaagacgccagccctgtccacccctccgagcctgtc ccagccaccgaccccagtgaagccagcacagccatcacctcctcctcccg agaccaaaccggcagtggctgccgctgcgacgccaccggtgggaggggtt gtgacgttcgagtaccagaggaaggtggccaaggagctacaggaatactt caagaagaagaagctggaggagaccaaccagggacccttctttgggtggt tggccaagaatgagattgccaatggaagatgggctatgtttgggtttgca gtggggatgctaacagagtacgcaacaggctcggatttcgttgagcaaat gaagatccttctctccaattttgggattgtggatttggattgatggctca tgtttggcggtgttgttctgtatttctataagtctgaagtataatctatc ttctttcatgtatanaaagatcaatcctgcacactattatatccttgant ttcatttgtgctgtcctgtcanttttgacnaatgtaaaatccaatttcca nctttctt
Download
page-top