Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716620
Length 557 bp
Fasta Format > whvd13a11
gtcgtgacggcagatcttgccgcggtgtctgctgacccaatgtcgctgcc gctcttgttgcactcgcagaggccctacggcgacatcttcaccgttgata tcgacccggatgacatggagaagaaccaggatgtggaggagtttgcccga gtcacgcatagcaggtacgagaacgccactcctgactggaccgtgttctc aactcatgacccgcatgcgcagtggaacctcctggtcatggaggaggagt acaccccggcgtgcccgtatgcgcatcatgatgggggtgaaagctggcac atgacaggtcagatgtgcatcccgaaaagggtctgttgatcttacgccgc tatgtcggaatggcccggataactgtgcctgtttcgcgcttgggctcata ctgttgcctggatttattgcttgagatgtatttgtaatttctgtttggat tgctgtctatttgggttggtgttgaggtgatttgcccggaccatttgcat tctacacatttcatcttgctgtaatatataaggcttcanagttttataaa aaaaaaa
Download
page-top