Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720906
Length 768 bp
Fasta Format > whvd9p02
agattgactgcctcaatgctagtgctgatagcatggtaggacgagcaaga ttccatctggaagagccggttatttctcgagagatctatgacattgagtt ccacgtggatgaagctaaggttcagctcaagaaactcgaggatgtaaaaa ctgctcatcttatcaatgactactctacaaccggcacacaagatgtagaa ttcaaagtccaagagaccagggagagtacctggagttctagtgtttcatt gaaagtggctgtcaagtcaaccattgaatctgggattccactcatagtga aaggggaaatagaaattagtgctgaatttgaaggaggatatagctgggga gaaactataaccaagacacaagagaccaccatgaaatatcaagtcattgt gcctccaatgtccaaggtcttggtgacggcgactcagtcacaaggtatat gtgatgtcccatactcatatacgcagaaggatgttctgctgaatggacac gaagttactcaccacttcacagatggcatttataggggtgttagtgtgtc tgatactacaatcaaagtcgaacccatgccgtgactagttatccctagtt attattgttagtttagaatactataagagtttggatatggaaaggttcgc cccgaacaaggttttcctgctgtctccaaattcagtttgaattgttttgt tttactccgatttgtaattggctttataagcccctcatcaatacaatgaa gcaagttgaatctaaaaa
Download
page-top