Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720883
Length 767 bp
Fasta Format > whvd9n21
gactttgccatgttgacttctaaaagtagtttacatgtgagaaaaatctc aaaatcttttcatcttgtaggctcaagcaaccatttcagattacttgcac caacatgaaataacaaaatcacttgtgactaaggagttggtttggttcct ggcttctgctttgctggctctacctgtgtttattatgtacaggcttctag tagataccttctggtagtttgttttactttcgttagccaatataattcta attatcaacgctgcgaccttgcgtgaactgatagcataattgccttgaaa cctcttgttgacacagcacgaagaagcagaagagatcgcctcttaatggt aacggaaacaatggcaataggagacacaagcgccgacatgctgagaagta aactatcgtcggctgccatgtagggttgcagaaatcagagcatgtccttc cctgatgaggctgcgctcctgttcatggtagaaggatggaacgctgtaca ccaccagattttttcgttttccttttgccccctattgtacggactctagt ttcagcagcggccttatgtatctgcatcttgccgaggtttaatatgggct taaacctcggcgtttgttaattgtttattgtaactttgttgatacgcttg agtttgtttgcagcgtgctttgctagtttttgttctcgctcatcggcatc ctaactatacgagatacggttgttctacaatttatgtaattaaaatccgt acgtgctaaaaaaaaaa
Download
page-top