Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720774
Length 516 bp
Fasta Format > whvd9g23
ttctgaaaaggtatctcttgctactgactttatgtataaccacatgtcca gagatgtgacttccagcgttggttacgattatatccttaggcagtgccgt ctaaggggcaaagttgactcaaatggtgtcgttgctgcatacttggagga gagattgaacatgggtgtcaactttcttctgtctgcagagattgaccatc caaagaagaactacaagtttggttttggaatgactgtaggagagtagata tgctcacagcaattactgtgagaggactacagatgtctcctcagttcgtt ataagtgcaggtttaccatatggtctcggttcaagtgttcgggacctaca gattcgctcctcaagcgttgcaggctttttcggtgtacttgcggttgtct catttcagctgctttagatagcatgggcatttgggcgtccatgattcttt gtttatctaaaacaagctgaaacgttgttgtaataatgttcacttggttg ttggagaaaaaaaaaa
Download
page-top