Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720747
Length 627 bp
Fasta Format > whvd9f05
ctacttcatcgtgctcacccagctgggcacctacgtcgtgctccaggccg cgcagatggaccgccggatcagcaagtccagcagcttccagatcccgcag ggctccttcgtcgtcttccagatgctcgccctcacgacgtggatccctgt ctacgaccggttcgtggtgccggcgctccgccgcttcacgaagcgcgagg gcggcatcaccctgctccagcggatcggcgtcgggttggcgttgtccgtg gcgacgatggtggtctcagcggccgtggagcagcgacgacggaaggtcgg ctcgtcgatgtcgtgcttctggctggtgccgcagcaactgctggcgggcc tgtcggaggcgttcggcgccatcgggcagattgaattctactaccggcag ttcccggagaacatgcggagcgtggcgggggcgctctacttcctggggtt cgccatggcgagctacgcaagcgggctgatggtgatggtggtgcaccggg cgacgcgcgggtgggacggtcancctgactggctggcgcaggacctggac gagggtagggtcnacctattctacctggtcaccnccgccatcncccgcnc gngaacctcatctactttgtgatctgt
Download
page-top