Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720746
Length 745 bp
Fasta Format > whvd9f04
cacctcctcgtcgggcgagcgcagcagaaatggcgaccctctccatggtc tccggccccgtcgccacctcgtctctccccctctccacccgccgccgcgc ctcctccgtctccctccccgcccccaagaagggaggcattggtcacggcg gcctgcggatcgagtgcatccgtatcggtggtgttgagatcccaaaccac aagagggtggagtactcgctgcagtacatccatggcatcgggcggaaccg ctcccgccagatccttttggacctcagcttcgacaacaaggtcaccaagg acctctccgaggaggaggtcatcacgctccgtaaggaggtcaccaagtac atgattgaaggagaccttaaacggttcaaccgtgtggcgattgagaggat gaaggagatccggtgctacaagggcatccggcacaagctcggcctcccgg tccgtggccagaggacaaagaacaactgcaggacgctcaaggggaagagg gcttccgtcgccaagaagaagtcggcttcgtcctccgacgaataagtgac actgccatgtgtatttgcctcctgtttggtttttgtttgctacatcacgg cgctaccaccattcggtactccgtttcaagtttccattccgtcgtagatg aattgtggggatatggtcggatgctgctgcaaagtttatagtcatgacat ctcttctgttatatatgcactgattctaaatcatcaaaaaaaaaa
Download
page-top