Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720699
Length 757 bp
Fasta Format > whvd9b08
accactctctctctctcgccggcgtctccccattcaccgcccccccgggt agagcacgagtcctccgagaagagcgcgaatccccaacccaggcagctgc ggtgcgccgccccccgcctaaacttagcggccgctccaggaataggcgcg gggcgcgcggggatggggtacctgccgtcctccctcggcagcaaggcggc gcacttcgtgtccgacctcaccaccgtcatcctcaaccccgtctccgagc gcgagccctcccacctccccgaggcggacgaagagcaagaaaaatcagaa gacgacaaagattctgaccataattctgataaccctgatggccccgatac atcttcgtttagagcattcatgatctcatttttgtcgccgtctagctctt ttaacgattcaagggagataatccccgagcagagtgaagaaatgggatac ccaactttaacaccagttgggaaggcaaccaagggaaagacaggcttgct aagcagagggaagcattccattggaaaaatcattaataaagcggctagga tgagcggtttcaaacaaaactcggaacctaaaactgacaaagaggtggcg agtcatgctgaatcagctgcacctgcattggagctcgaaggaccaaatga agttaactccctgaccaacatgccagctatgtcagagccatctgtccttt tgtcagaaacaatgcgatccactctttattcctctcttcctattctggcc caaggaa
Download
page-top