Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720560
Length 763 bp
Fasta Format > whvd8j03
gcgttcgggttccctgcggacctcgattgcgatgcgctcatgcggggcct ggcgctagaagcagaccttgctggtgcgccagatctgtcccgcctgaccc tccgaggcgtccgcccgttctccacttgtatccatgccgtcgacaagaac ctgattatcatgataacttcctttcctcaagtttacccccggggtatcta tctcatctacaacgcaattgacagatcgctcctcatgatcccgtctgcgc ccagcacacccccttccgtccttacgtcccgtgttcttgtggcgcgccgc cgggacgacgacatcagctcctacgccctggtctttcccgggaccgtcta cgacataggctgtcctggacggcagcctgttctcttcgtgtcgggatcct catctaagtctcagtgggagattgcgaagttcactaatttccccgaccat ctgctcgctgagaaaagctctttccttgccgaagatgtgttctcccaccg tggccgtggttactgggtggatctcttgcttggtggcatgtactgtgact gcggtgatgtgttctccagccagcgttacatggacgcccactccttagac ctccctgtggggtgcgagagatacttaggctgtanagattacataccana gccgagggcctttcgagctgtgggctgtgttggggactccatcaagtttg tctccatcaccggcttccttgancgtgtggatcttgtggatgaccgcatg gtgaagggtctgg
Download
page-top