Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ720094
Length 662 bp
Fasta Format > whvd6m04
tctcactgagctcgcaggcagccctagccaccancgaaatggccgcgtcg gcgctgcaccagacgaccagcttcctcggcaccgccccgcggcgcgatga cctcgtccgcagcgtcggcgacttcggcggccgcatcaccatgcgccgga ccgtcaagagcgcgccccagagcatctggtacggccctgaccgtcccaag tacctgggcccgttctccgagcagaccccgtcgtacctgaccggcgagtt ccccggcgactacggatgggacaccgccggattgtcggctgacccagaga ccttcgccaagaaccgggagctggaggtgatccactcgcggtgggcgatg ctcggcgccctgggctgcgtgttcccggagatcctgtccaagaacggcat caagttcggcgaggccgtgtggttcaaggccggcgcccagatcttctccg agggcggcctcgantacctgggcaaccccaacctggtgcacgcgcanagc atcctggccatctgggcggttcaggtggtgctcatgggcttcattgaggg ttaccgtgttggtggcggccccctcggcgagggcctcgacatcatctacc cgggcggcgccttcnacccgcttggcctngtccgacgaccccganaccgc cgcgganctcaa
Download
page-top