Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ719581
Length 777 bp
Fasta Format > whvd4i08
cctcggcgagaccccgttcaccgacctcacccacgacgagttcatggcca tgtacagcagcaacgacgagtcgtcatgggagtcggaggagatgacggtg atcacaactcgcgctggccccgtccacgagggcaccgccgccgtcgaaga gccacctcgtcataccaataccaatctgacggcggtggtgcctgcgagcg tcgattggagggagaaaggcgtcgtcacagcagccaagtatcaaggggaa tcctgttcgtcttgctgggcgttcacgtcggtggcgacgatggagagcgc gcatgcgatcagcacgggcggatcgccaccggtgctgtcggagcagcagc tggtggactgtcggattaacggctgcggcaacagttggatggacaaggcc ttcgagtgggtgatccagaacggtggcatcaccacggaggcggcctaccc ctacaccggcaaggtgggcacgtgccaaagggccaagccggtcgcggtga agctcanaggctacaagaagatttcaccacccggtgacgaggcggcgctg atggcggccgtggcgcancancccgtcgccgcatccttcgactacagtga cccctgcttccagcactacatccgcggcgtgtacaacgccggttgctcca ngtcgggcgtgtacaacaaaggggcgtgcgggacaacncanaaccacncg ctggccatcgtcgggtacnggaccaancctgacnggaccaantactggat tggcaanaactcntggactgaccantg
Download
page-top