Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ719495
Length 764 bp
Fasta Format > whvd4c08
tggagaggcacacctgtgtccaagttgatcggttcaccaccaggctatgt gggatacactgaaggtgggcagctgacggaggcggttcgacggcggccat acagcgttgtgctttttgatgagattgagaaggcacatccggatgtgttc aacatgatgctccagatcctggaagacggaaggttaaccgacagcaaggg gagaacagtggacttcaagaacacgctcctgataatgacatcaaatgttg ggagcagcgtgattgagaagggggggaggaagatcgggttcgacctcgac tcggacgagaaggacagcagctatggcaggatcaagagcttggtgatcga ggagatgaagcagtacttccgaccagagtttctcaaccgtctggacgaga tgatcgtcttcagacagctgaccaagctggaagtcaaagagatcgcggac ataatgctgcaggaggttttcaccaggctcaagaccaaggacatcaacct gcaggtgacggagaagttcaaggagcgggtcgtggacgaagggtacaacc ctagctacggagcgcggccgctgaggagggccatcatgaggctcctggag gacagcctcgcggagaagattttgggcggggaggtcaaggagggcgactc tgtcatcgttgatgtggacccggaggggaaagtcattgtgctgaatggcn anagcggactgccggancttccaaccccggcggtcnctgtttanttgttg gtactgtatanaat
Download
page-top