Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ719357
Length 704 bp
Fasta Format > whvd3j18
caaccgctgctattggaaagggtttcgccattggatcagctgctcttgtg tccctggcacttttcggtgcctttgtcagcagagctggtgtgaaggtcgt tgatgtcctatctcccaaggtgttcattggcctgattgtcggagccatgc ttccgtactggttctctgccatgaccatgaagagtgttggaagtgctgct ctcaagatggttgaggaggtccgcaggcagttcaataccatccctggact gatggagggaactgccaagcccgactatgccacctgtgtcaagatctcca ctgatgcttccatcagggagatgattcctccgggtgctttggtcatgctc acccccctcattgtcggaaccctcttcggcgtggaaaccctgtctggtgt tcttgctggtgcccttgtttctggagtacagatcgccatctctgcttcca acaccggcggtgcatgggacaacgcaaagaagtacattgaggccggcaac agcgagcacgcgaggtcccttggccccaagggttcagactgccacaaggc ggccgtgatcggcgacaccatcggagaccccctcaaggacacctcaggcc cgtcgctcaacatcctcatcaagctgatggccgtcgagtccctcgtgttc gcgcccttcttcnccacgtacggaggtgtgctgttcaagtacatctanaa nact
Download
page-top