Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ719331
Length 615 bp
Fasta Format > whvd3i05
caatattacataaggtcataaccngtgtgattccagatgctgttggnaan aagcttattggccttggganaagcanagatgaaattgctgatcttcnaaa gcttgacgatgtgattgatcttgttattccannaggcagtaacaggcttg tttctcaaatcaaagcacaaaccaagattcccgttctgggtcatgctgat ggtatctgccatgtttatattgataaatcagctgacatggacatggcaaa acgtatagtattggatgcaaaggttgattatcctgcagcgtgtaatgcta tggaaacactgcttgttcataaagatctgaacaagacagagggtcttgat gatttattgatggaacttgcgaaagaaggagttgttatttatggtgggcc tgtcgcacatgacacattgaaagtaccgaaggtagattcatttcatcatg agtatagctcaatggcatgcaccctcnaatttgttgatgatgtgcagtca gcgattgaccatataaatcgttatggaagtgcacacacagattgtattat cacaactgataanaagtcagcggatacttttctacaacaagttgacagtg ctgctgtgttccata
Download
page-top