Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716613
Length 212 bp
Fasta Format > whvd12p21
gccggagaccggcgaggtgatcngcgtcttctagagcgtgcanccgtcag acaccgacctcngcgccaaggcgcccaaggatgtcnngatccanggtgtg tggtacncgcagctcgagtctaactatagcagagcataagtgaagatact catcttgtgtgcatgcgtacgtgggttgatcggtggagaggaaacaatcg aggcaacaatgt
Download
page-top