Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716594
Length 817 bp
Fasta Format > whvd12o15
cctcccgtttccacctctctatcctatggatagagccgccgcgacagcca tagatatcctcgctatgatcccatcagcgccctctcctttgtagcaccat ctcccctcccccaccccacccccgggtttatttgacaagatttgatccca atcctcgcacgtttcttggccgagtgggggagaagattccagaaatggct gtcgccgtagctgccgggaccctccgtacctgttccggcgtatttccggc ggcgtccgggaaccatccgcttgccgggtggcggccacttgcaccggcag cgcccgctaagctgagattattgtctccagctttgagggttcctagagct gcttcgcctgcagctgttgagaatgggagctctagcaacagtaatacagt ccctacaccgaaggttataatagatcaagactcagatccggatgcaacta ttgtggaagtaaccttgggtgaccgtcttggggatcttcttgatactatg agtgccttgaggaatttagggctaaatgttgtgaaagctagtgtttgcct cgattcttctggcaagcacaataagttcgctataacaaagtcgtcaactg gtcgcaaaattgatgacccagagttgttagaagcagtaagactgacaatt attaacaacatgcttgagtatcatcctgaagctagcagtcaatcggccat gggtgcaacttttgggctagagccccctacggaagtgggttgatgtggac atagcaactcacatagagatctatgacgatggtcctgaaagaagtttact tgttgtggaatcanctg
Download
page-top