Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716544
Length 691 bp
Fasta Format > whvd12l18
tcgcacatgacacattgaaagtaccgaaggtagattcatttcatcatgag tatagctcaatggcatgcaccctcgaatttgttgatgatgtgcagtcagc gattgaccatataaatcgttatggaagtgcacacacagattgtattatca caactgataagaagtcagcggatacttttctacaacaagttgacagtgct gctgtgttccataatgcaagcacaaggttctgtgatgggactcgctttgg tctaggtgcagaggttggcataagtacagggcgcatacatgcccgtggac ctgttggcgtcgacggtcttttaaccactcggtgcattctgcgagggagt ggacaagtagtgaacggtgacaagggagttgtgtacacccacaaggatct tcctttgcaatgagggtagaggattcctgctgtagagcaatttttataga ataatcctcttcaaagcccccttctctctgtgcgaggaatgaagaaagac aagagagcattgttgttactatgtcgctatctagttccgtgattattcgt gtacaatgatttatccatacaatgtcgtagttatggcactagctgttgta actgtagaattgcatcggtacatctatgctacatatatgaagtagctgta ctgtttctgatgaattctcgaatccgttgtcaaaaaaaaaa
Download
page-top