Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716353
Length 719 bp
Fasta Format > whvd11p14
ggcctctttcactactaccaccgagccaccatcccctacaagggagagca gagaacacacattcactttgttgcttcaggttgcaacacctaaattaggc tacaatggctctgaggctgtgggcgagctcagctgccaatgccctcaaga tttcaagcagcggcgccagggctgctgccccggcctattcgatctccaga tacttctccactgttattgatggcttgaagtacacttcctcccacgagtg ggtcaagaacgacggctccgtggccacgattggcatcagtgaccacgccc agggccatctcggggaggtggtgttcgtggagctgccggaggccggcacg aaggtgagccagggcggagccttcggcaacgtggagagtgtgaaggccac cagcgacgtcaactcgcccatctccggcgaggtcgtcgaggtcaactcaa agctgtccgagacccccggccttatcaactcgagcccgtacgaggagggg tggatgatcaaggtgaagccgagcagcccggcggagctggagggcctgct ggactcggccaagtacaccaagcactgcgaggaggaggacgcccactagt gctccttgctcgattatcgttccttttttgttgcaaccatgtcgactact cttgtctacaataattaaaccagcttcaccatgcgttcagttcatcggtt ccagttttcaaaaaaaaaa
Download
page-top