Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716092
Length 758 bp
Fasta Format > whvd10p10
cagatggccggcttcgccctcgccacctctgccctcctcgtctccggcgc gagcgcggagggggcgcccaagaggctgaccttcgacgagatccagagca agacctacatggaggtgaagggtaccggcaccgcgaaccagtgcccgacc atcgacggcggcgtcgactccttccccttcaaggccggcaagtacgagat gaagaagttctgcctggagcccacctccttcaccgtcaaggccgagggca tccagaagaacgagccgccggccttccagaagaccaagctcatgacccgt ctcacctacacccttgacgagatggaaggcccgctcgaggtcggcgccga cggcaccctcaagttcgaggagaaggacggcatcgactacgcggccgtca ccgtgcagctccccggaggcgagcgcgtgcccttcctcttcaccgtcaag cagctcgtcgccaccggcaagcccgagagcttcagcgggcccttcctcgt gcccagctacaggggttcgtctttcctcgacccaaagggccgtggtggct ctactggctacgacaacgccgtggcgctacccgccggaggcanaggagac naggaggagttggccaagganaacgtgaanaacgcntcctcctccacggg caacatcacgctcancgtcaccaanancaagccgganaccggcgaggtga tcngcgtcttcnanagcgtgcanccgtcanacaccnacctcngnnccaag gnncccaa
Download
page-top