Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ716010
Length 729 bp
Fasta Format > whvd10j24
ggcagctcaaccaagcaatgtctttggcaccttccatcccttccatcaag gtgaaggtgggacgcatcgccccgccgcctccgtaccgggcatgcaagtc gttcgccgtgatcaggagctccaaggccgaggggcccaggagacccacgg cgcctccactgtcgccgcccccgcctatgcctcccaagacgccagccctg tccacccctccgagcctgtcccagccaccgaccccagtgaagccagcaca gccatcacctcctcctcccgagaccaaaccggcagtggctgccgctgcga cgccaccggtgggaggggttgtgacgttcgagtaccagaggaaggtggcc aaggagctacaggaatacttcaagaagaagaagctggaggagaccaacca gggacccttctttgggtggttggccaagaatgagattgccaatggaagat gggctatgtttgggtttgcagtggggatgctaacagagtacgcaacaggc tcggatttcgttgagcaaatgaagatccttctctccaattttgggattgt ggatttggattgatggctcatgtttggcggtgttgttctgtatttctata agtctgaagtataatctatcttctttcatgtatagaaagatcaatcctgc acactattatatccttgagtttcatttgtgctgtcctgtcagttttgacg aatgtaaaatccaatttccaaaaaaaaaa
Download
page-top