Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715961
Length 141 bp
Fasta Format > whvd10g19
cgagagatgcccattcggtggcacgatggcgagcttgctgagatactgta gaggggaacaaatgaattgcccttgttgtcgtgaaactgatgtgatggat taaagaataaatatattcagcatttcagcccaaaaaaaaaa
Download
page-top