Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715958
Length 755 bp
Fasta Format > whvd10g09
cggtttcccccatgggttttggaacatgggcttggggcaaccagctgctc tggggctaccaggaaagcatggatagtgaactgcaggagtgtttcaattt ggctctgaagaatggcataaaccttttcgacaccgccgactcttatggaa ctgggaagttgaatggccaaagcgaaaggctgctcggaaaatttatccgc gagtgccaagggccaataaagtctccagatgatgtgattatcgcaactaa gtttgctgcgtatccttggcgactaacgtcaggccagtttgtcaacgcct gcaagtcatcattagaaaggttacagatcgatcggctcggaatagggcag ctgcattggtctactgctaactatgcacctctgcaggagcgcgctctctg ggacggtctagttgaaatgtatgacaagggtcttgtccgagccgtgggtg tgagcaattatgggccgaagcagcttgtgaagatccacagctacctagca tccagaggtgtccccctgagctcagctcaggtgcagttctcgctgctgag catgggcgatgagcagatggagctgaaaaccgtgtgcgattccctgggtg ttcagctaatcgcttatagccctcttgggttgggcatgctcaccgggaaa tatgacgcctctaaccttccaaatgggccaagatctgtgttgttccggca gattcttcctgggctggaatccctgctgtcttgcttgaagagtattgccg accga
Download
page-top