Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715951
Length 366 bp
Fasta Format > whvd10f22
ccgacgttcgtgctattcaagaagtgcaagcaggtgggcaaggtcgtcgg cctcaaggacgacgaactcgagcggagcatcgagcgagcgctaaactagt actcaatgtttttcgtgtcaagacttataatatggccttcatatacgcat cgggagtgcgaggtacatgcatgtgcatgctacagaactactgtatgtag ctggaataagcatggtacgaaacttgtcgagagatgttgagtatcagatg tactactccatggacctatatatgctcctgcatggtatatgagctagaat tttaggagacataaatattaaaaattcatgaataaatttagcatttataa ctaatcaaaaaaaaaa
Download
page-top