Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715950
Length 799 bp
Fasta Format > whvd10f21
agctatatacctacatagtacagccatgggcccccaccgatgatggcctc gtcggccacctccgtcgctcctttccaggggctcaagtccaccgccggcc tccccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaac ggtggaaggatcaggtgcatgcaggtgtggcccattgagggcatcaagaa gttcgagaccctgtcctacttgccaccgctcagcacggaggccctcctca agcaggtcgactacctgatccgctccaagtgggtgccttgcctcgagttc agcaaggttgggttcatcttccgtgagcacaacgcatcccctgggtacta tgatggccggtactggacaatgtggaagctgcctatgttcgggtgcaccg acgccacacaagtgatcaacgaggtggaggaggtcaagaaggagtaccct gacgcgtatgtccgcatcatcggattcgacaacatgcgccaggtgcantg cgtcagcttcatcgccttcaagccaccgggctgcgaggagtccggcaagg cctaaacagctcactcacgacaggccatatataaagtgccattgcagttt tgtcaactctgacattgctttgggttttccttctccatttatctttctta tttgttcctaagaatatgtgtatgtccatgttcatgtaccaacatggctc gagaaagcatgctcgtatganaatgctatcggtggctatgtatatgaacg gacgcataatattatacaatatgtcnactatatacgttttaatggtaac
Download
page-top