Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715949
Length 815 bp
Fasta Format > whvd10f20
gcccgcagagccggaagccacacacacacgccttcctccttcctctgctc gcatctcggatcggggagaaggaggatctgaggctttcggcagggccggg gacgatggcgccgctgctcaaggacgagctggacatcgtcatcccgacga tccggaacctggacttcctcgagatgtggaggcccttcttccagccgtac cacctcatcatcgtgcaggacggcgaccccacgaggaccgtcatggtgcc cgagggcttcgactacgagctctacaaccgcaacgacatcaaccgcatcc tcggccccaaggcctcctgcatctccttcaaggactccgcctgccgctgc ttcggctacatggtctccaagaagaagtacgtctacaccatcgacgacga ctgcttcgtggccaaggacccgacggggaaggacattgacgcgctggcca agcacatccagaacctgctctgcccctccacgccgctcttcttcaacacc ctgtacgacccctaccaggagggcgccgacttcgtgcgcggctacccgtt cagcctccgggagggcgtgcccaccgccgtgtcgcacggcctctggctca acatccccgactacgacgcccccacgcagctggtcaagccgcgggagcgc aacggcaggtacgtcgacgccgtcatgaccatccccaagggctccctctt ccccatgtgcggcatgaacctcgccttcgaccgcgagctcatcggcccgg ccatgtacttcggcctcatgggcgacggccagcccatcggacgctacgac gacatgtgggccggc
Download
page-top