Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715948
Length 769 bp
Fasta Format > whvd10f19
actcttggtgctctccgctccctggtcgttcggtcgttggaagttggaac ctcctcctcctcctccgcagccgcgggcggcgtcgggaggtttccgggct gcgcgttggtgcatgcaacagaggggcctctccaacaaccgccgctcccg cggcttctcccgatcccgcctcgccgtcgagggcgcctaaacagaacccc accgccacccccggcccagccaacacacacaccacaccttcttaacaaca aacacacaccagagctcacacccaacgacgacactcccctgctcccttcc tttcgcctctgaaaaactttgaaacgagagaagaagatggacaccatcac cgtcgtcgagaatgtgttcggggaggtggagcgcaaggtgcagaagagct actgggaggagcactccaaggacctcaccgtggagtccatgatgctcgac tcccgcgccaaggacctcgacaaggaggagaggccagaggtgctggccat cctgccgtcgtacgcggggaagacggtgctggagctcggcgccggcatcg gccgcttcaccggcgagctggccaaggaggccggccacgtcatcgcgctc gacttcatcgacagcgtcatcaagaagaacgaggagatcaatggggacat ctacaagaacatcaccttcatgtgcgccgacgtcacctcgccggagctca agatcgaggacaactccattgacatcgtcttctccaactggctgctcatg tacctcaacgacgaggagg
Download
page-top