Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715947
Length 808 bp
Fasta Format > whvd10f18
ggctccgcttggaggatcagctttggttcagacttcagaggcaggttttg ggcataccgcagcacaagcagaggcagatctcagtcaatgctactgcagt tgatgatgccctgaagctttcttcagtaactgactcagcgtgctgctgtt ctctaaggtcgttgagtgctgagaacaggcaatataattaggattttaac gagaagttggaggagataaaaactttcaggaagtgtttaggcgagttcca tgccgaaaataatgttatgtgagcagagagtgcaggcttgtgctcttctg ttgaagagcttgagcatgagagattgaatcaacacataagtcatgagagc atatctttagacgaggagaggcgactggtcaaagaaattaagacccttga aaaaaccagaccgagggtcagttccaaggctgctaagcaagctaaaatgc aagatatagtggttgagagagatgccatacaggatcaggtgaaaatcatc atacatggactaaaggagggaaaagcagccaggtctaagattaaggtcct gggcgataaggcgatgggcgtggagagctgctacgagcttgcgcaggcgg cgtactcaacctcgtgctgcacacgctcaagcacctggcggccgtcgtca atgggctcctcgtccatgattacctggacaacatgaacctcgaggaggtt gtgaaggggaacatctgtgacgccgttctttaggtgctcgcccatgtcta tgtaattatctctttattgcttctaaattaatgcccaacagattagcgtg cttctgag
Download
page-top