Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715945
Length 817 bp
Fasta Format > whvd10f15
agtggctggtatggaaggaactgtcatgacagatgggaagagcaaaagcc ttgttgcttaccacgaagttgggcatgcagtttgcggaactttgacgcct ggccacgaccccgtccagaaggttaccttagttccaaggggtcaagcccg tggtctcacctggttcattcccatggatgacccaacgctcatctctaggc agcagctcttcgccagaatagtcggcggccttggcggcagagctgctgag gagatcatattcggagattctgaggtgaccactggagctgctggtgacct gcagcagatcactggcttagccaagcagatggtggtgacatttggcatgt cggacatcggcccgtggtctctgatggacgcggcgcagagcggggacgtg atcatgcggatgatggctcggaactccatgtcggagaagctggcgctgga catcgactcggcggtgaagcagctgtcggaccaggcctaccagatcgccc tgcaacaggtgagggacaaccgcgtggccatggacaagatcgtggaggtg ctcctggagaaggagacgctgagcggcgacgagttccgggccatcctgtc cgagttcaccgagatccccgtcgagaaccgggtgcccccgacgccccagg cggccgtcccggtctaggttcgcccgcatttatagggttggagaatttgt tgttgttgtaagatgttcatatttcttggatgtacactaattcctactcn aggcacggcatgtaatgtaactcactcncggttaattataanatgtaatt acttgggaaaaaaaaaa
Download
page-top