Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715942
Length 438 bp
Fasta Format > whvd10f11
agccggccgaggaacacgaagaagccgaggacggttcagcagagaccgtg cacgcagtcgtcgccactagtgttgcagaaagcagtgaggccgccgctgc tacgcctgctcctcctgtgcccgctcgaccaaggtggaggcgttgggcgt gctttagttgcctcaagtccggcagcagttcttctcactagtgtggtgct ctgaagatggctcaggacttctgaataattgcgttgctgtggttagtagt cggttgaactgcactacttttgttggaacttcttaagctgtttgttgcta ttgtttggcttgcaataggatactgtgatgcgccaggttttttgccccgt agtctatgtttggcctagatcgatcaggcatagacagcgggttttcctgg cgggtttgaattatccttttccatttacaaaaaaaaaa
Download
page-top