Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715938
Length 821 bp
Fasta Format > whvd10f02
gccccttctccctcactttgggctcgaggcaatggcggcgctcgctccga cgaagatgctcggcacccggctcaacttcgccggctcctccaggtacgcc acagcggcaccaactgctggcgcacagaagatcgtctccctctttgatcg cttcaagaagaagcccgccccgaagccgaagcccgcccccgtggccacct cgagcgtgggcatcgacgacgagctcgccaagtggtacggtcctgacagg aggatctacttgcccaacggtctccttgaccggtcggaggtgccggagta cctcaacggagaggttcccggagactacggctatgatccttttggcctgg gcaagaagccagaggacttcgccaagtaccaggcctttgagctcatccat gccaggtgggccatgctcggcgccgccggattcatcatccccgaggcgct caacaagttcggcgcaaactgcggtcccgaggcagtttggttcaagaccg gcgccctgctccttgacgggaacaccctcaactacttcggcaacagcatc cccatcaacctcatcctcgccgtcgtcgccgaggtcgtcctcgtcggagg cgccgagtactacaggatcaccaacgggctggaatttgacgacaagctcc accccggtggcccattcnacccgctcggcctcnccaccgaccccgaccan gcggcgctgctcaaggtgaanganatcaagaacgggcggctggccatgtt ctccatgctgggcttcttcatccangcctacgtcaccggcnagggcccct tcnanaacctgtgcgcgcacc
Download
page-top