Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715935
Length 857 bp
Fasta Format > whvd10e20
actcgcccactgggtactgcatagggagccgctcgcccaccgctacattt tctgctctcttctggataagccaagccccacctctttcgcttccattttc cacccccagacaataaatatacttggtcacttatctctataataaagttg cgctcgtgtttcccctaaaaaaagggttgcgctcgtgctcgattccgagg aacggccgttgctgttggcacattgatggcaatggagggaccaattcttt gtcgccctataatgcaagcaaggcttcctgctgcccttgtcaacaactca ttgatcaaatctgggcagcttggcactgcattcttgggtgctgtgtctaa ataccgcaacattactagactagtttctccaatctctcagtcatcttcaa agaactttggtcctatttgtcgtagcttcagctcctcatctgatggtaat ggatacatggctggaaacttcaatgagaatgatgaagattatgttaattc cactgtgcttgaagctgttgaggtcagaagtggatcagaaggatatatag taaagatgcgagatgggaaaaacctgcggtgtgtgcataataattctcaa gggagagagattccagagagtgcaccacaacctgctatcgttttgagaat tgaagatggaagtggaactttacttccaatcattgttttggagatgccaa gtgtacttctgatggctgctattcgccatgttcatattgcaagacctacc atatatcaagttgttaaggaactgatcgataagatgggctatgaggtaaa aacttgttcgggtaaacaaaagaattcaagaagcatactgtgccgagctt tatctaa
Download
page-top