Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715928
Length 769 bp
Fasta Format > whvd10e03
gcctcctcctagcaagctatatacctacatagcacagccatggcccccac cgtgatggcctcgtcggccacctccgtcgctcctttccaggggctcaagt ccaccgccggcctccccgtcagccgccgctccaacggcgctagcctcggc agcgtcagcaacggtggaaggatcaggtgcatgcaggtgtggcccatcga gggcatcaagaagttcgagaccctgtcctacctgccaccgctcagcacgg aggccctcctcaagcaggtcgactacctgatccgctccaaatgggtgcct tgcctcgagttcagcaaggttgggttcatcttccgtgagcacaacgcatc ccctgggtactacgatggccggtactggacaatgtggaagctgcctatgt tcgggtgcaccgacgccacacaggtgatcaacgaggtggaagaggtcaag aaggagtaccctgacgcgtacgtccgcatcatcggattcgacaacatgcg ccaggtgcagtgcgtcagcttcatcgccttcaagccaccgggctgcgagg agtccggcaaggcctaaacagctcactcaccacgggccacatataaagtg ccattgcggttttgtcaactctgacattgctttgggttttccttctccat ttatctttcttgtttgttcctaagaatatgtgtatgtccatgttcatgta ccaacatgtctcgagaaagcatgctcgtatgtgaatgcaatcggtggcta tgtatatgcaaaaaaaaaa
Download
page-top