Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715925
Length 352 bp
Fasta Format > whvd10d21
acgacctccgcctgagggcctcctacctgcgctacgacctcaagaccgtc atctcctccaagaccaccaaggaggaaaagaaggacctcaaggacctcac cggcaagctcttcgccaccctcgacgggcttgaccatgcagccaagatca agagccccaccgaggccgagaagtactacggagagaccaagaccgttctt ggcgatgtcctcgccaagctaggctagatggatccgcataatggccgtgt tgctttcaggccttttatgtttgttcatatttggaagccggcaatgtaac ttccctgttgataatatgtcaacaagcactaagtatgattccaaaaaaaa aa
Download
page-top