Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715923
Length 799 bp
Fasta Format > whvd10d15
gctatatacctacatagtacagccatggcccccaccgntgatggcctcgt cggccacctccgntcgctcctttccaggggctcaagtccaccgccggcct ccccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaacg gtggaaggatcaggtgcatgcaggtgtggcccatcgagggcatcaagaag ttcgagaccctgtcttacctgccaccgctcagcacggaggccctcctcaa gcaggtcgactacctgatccgctccaagtgggtgccttgcctcgagttca gcaaggttgggttcatcttccgtgagcacaacgcatctcctgggtactac gatggccggtattggacaatgtggaagctgcctatgttcgggtgcactga cgccacacaggtgatcaacgaggtggaggaggtcaagaaggagtaccctg acgcgtatgtccgcatcatcggattcgacaacatgcgtcaggtgcagtgc gtcagcttcatcgccttcaagccaccgggctgcgaggagtccggcaaggc ctaaacagctcactcacgacaggccatatataaagtgccattgcagtttt gtcaactctgacattgctttgggttttccttctccatttatctttcttat ttgttcctaanaatatgtgtatgtccatgttcatgtaccaacatggctcg agaaagcatgctcgtatgtgaatgctatcggtggctatgtatatgcacgg acgcataatattatacaatatgtcaactatatacgttttaaaaaaaaaa
Download
page-top