Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715917
Length 791 bp
Fasta Format > whvd10d03
gctatatacctacatagtacagccatggcccccaccgntgatggcctcgn tcggccacctccgntcgctcctttccaggggctcaagtccaccgccggcc tccccgtcagccgccgctccaacggcgctagcctcggcagcgtcagcaac ggtggaaggatcaggtgcatgcaggtgtggcccatcgagggcatcaagaa gttcgagaccctgtcttacctgccaccgctcagcacggaggccctcctca agcaggtggactacctgatccgctccaagtgggtgccttgccttgagttc agcaaggtcgggttcatcttccgtgagcacaatgcgtctcccgggtacta cgacggccgctactggacaatgtggaagctgcctatgttcgggtgcaccg acgccacacaggtgatcaacgaggtggaggaggtcaagaaggagtaccct gacgcgtacgtccgcatcatcggattcgacaacatgcgccaggtgcagtg cgtcagcttcattgccttcaagccaccgggctgcgaggagtccggcaagg cctaaacagctcactcaccacgggccacatataaagtgccattgcagttt tgtcaactctgacattgctttgggttttccttctccatttgtctttctta cttgttcctaagaatatgtgtatgtccatgttcatgtaacaacatggctc gagaaagcgtgctcgtatgtgaatgcaatcggtggctatgtatatgcaca tgcacataatatattatacaatctgtcgactaaaaaaaaaa
Download
page-top