Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715905
Length 583 bp
Fasta Format > whvd10c08
ttgagagagcgcgcgcgagatggcagcctccatgatcacctcgccgattg tggcgccgacgagcgtcccctccctctcccgccggggttcctccttcgcc gtcgtctgcagcggtggcaagaagatcaaggtcgacaagccccttggact tggaggcggcttgacagtcgacatcgacgccaacggcaggaaggtgggca agaagggcgtgtaccagttcgttgacaagtacggcgccaacgtcgacggc tacagcccaatctacacgccagaggaatggtctgaatctggtgaccgcta cgccggcggaacgaccgggcttcttatctgggccgtcaccctcgccggcc tcctcggcggcggcgtcctcctcgtctacaacaccagcgctctcgccggc taagagagcatctacgtgtaacacagggccgggtctctgcttgcatgcac gtctctgtaatctacatagctacctcctgtgaatgtatgcaatcaacgat gcaaagtaattgatccgaacagatggtttatgtgtatgtacgtaacgctg taacgatatacttcctactttggaaaaaaaaaa
Download
page-top