Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715903
Length 669 bp
Fasta Format > whvd10c04
gcagagaggagcagagaggaggaggaggagaccatgtcgtcgtccggtgg caaggtgttcaccctcgaggaggtcgccaagcacacctccaaggacgact gctggctagtcatcggcggcaaggtgtacaatgtgaccaagtttcttgat gaccaccctggaggcgacgatgtcttgctgtcttcaaccgccaaggacgc gaccgacgactttgaggatgtggggcacagcacgaccgcccgggcgatga tggatgagtactatgttggtgagatcgacgcgaccacgatacccaccaag gtcaagtacacgccgcccaagcagccgcactacaaccaggacaagacccc cgagttcgtcatcaagatcctccagttcttggtccccctcgcgatactgg gcttggccgtcgccgtacggatctacaccaaggcggagtctgtctagcac cgtcgtcttataccagtcagtcagtcagtcattcggaagtgtccaagagc tgaataagttttagtggggatttgcattttgtaccagcgtcaccgtcctg tcatgaaatctgggaactgttctcgacccgtcgttgcgttatggttctaa gacgtccgctgttgaaatcgtgactcgggaaaacggatagatacttggct atattttccaaaaaaaaaa
Download
page-top