Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715901
Length 757 bp
Fasta Format > whvd10c01
cgccgcggctaactggtgctacgcaaccgtagtcgcgccccgtgcccgct cctccaccatcgtcgccagcctcggcacccccgcgccctccaactcctcc tccttccgccccaagctcatcaggaacacccccgtccaggccgcccccgt cgcacccgcattgatggacgccgccgtggagcgcctcaagaccgggttcg agaagttcaagaccgaggtctacgacaagaagcccgatttcttcgagccc ctcaaggccggccaggcgcccaagtacatggtgttcgcgtgcgccgactc ccgtgtgtgcccctcggtcaccctgggcctggagcccggcgaggccttca ccatccgcaacatcgccaacatggtcccctcctactgcaagaacaagtac gccggtgttggatcggccatcgaatacgccgtctgtgctctcaaggttga ggtcatcgtggtgattggccacagccgctgcggtggaatcaaggctctgc tctcactcaaggatggcgcagacgactccttccacttcgtcgaggactgg gtcaggatcggcttcccggccaagaagaaggtgcagactgagtgcgcctc catgcctttcgatgaccagtgcaccgtcctcgaaaaggaggcagtgaacg tgtccctccagaacctcctgacctacccgttcgtcaaggagggtgtgtcc aacggaaccctcaagctggtcggcggtcactacnacttcgtctccggcaa gttcgag
Download
page-top