Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715897
Length 771 bp
Fasta Format > whvd10b21
gagagcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcct cgagcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgag gtcaacgagatctccatggccaactcccggcagaacatccggaagctggt gaaggatggtttcatcatcaggaagcctcagaagatccactccaggtctc gtgcaaggagggcacatgaggccaagcagaagggccgtcactctggatat ggtaagcgtaggggtaccagggaggctaggctccccaccaagatcctgtg gatgcggaggatgcgtgtcctgaggcgccttctgcgcaagtaccgtgagg ccaagaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaag ggtaacatgttcaagaacaagagggtcctcatggagagtatccacaagtc caaggctgagaaggcaagagagaagaccctctctgaccagtttgaggcca agcgcgccaagagcaaggcaagcagggagaggaagattgccaggagggag gagagattggctcagggcccgagagatcatgcaccagcaccagcggctgc agctcccgctcaggcagcagctgcacctaagaaggccaagaagtgaaggt ctgataagaagctttatctttctggtaatatcaagggttagcctaatttt ggaacatcanaagttcagaactgttttctgtgcaatatcttgtttgtgtc ancgtgtcggataccttaaat
Download
page-top