Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715895
Length 808 bp
Fasta Format > whvd10b16
tgatatcttggcagcattccgagtaagtcctcagcctggggttccgcccg aagaagcaggggctgcagtagctgccgaatcttctactggtacatggaca actgtttggactgatggacttaccagtcttgatcgttacaaaggacgatg ctatcacatcgagcctgttgctggggaagacagccaatggatctgttatg tagcttatccattagacctatttgaagagggttccgttactaacatgttt acttccattgtaggtaacgtatttggtttcaaagccctacgtgctctacg tttggaggatctacgaattccccctacttattcaaaaactttccaaggcc cgcctcatggtatccaagttgaaagagataagttgaacaagtatggtcgt cctttattgggatgtactattaaaccaaaattgggattatccgcaaaaaa ttatggtagagcgtgttatgagtgtctacgtggtggacttgattttacca aagatgatgaaaacgtaaactcacaaccatttatgcgctggagagaccgt tttgtcttttgtgccgaagctatttataaatcacaggccgaaaccggtga aatcaaggggcattacttgaatgcgactgcgggtacatgtgaagaaatga ttaagagagctgtatttgcaagagaattaggggttcctattgtaatgcat gactacttaactgggggattcaccgcaaatactactttggctcattattg ccgcgacaatggcctacttcttcacattcaccgtgcaatgcatgcagtta ttgataga
Download
page-top