Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715889
Length 813 bp
Fasta Format > whvd10b08
caggagcttctctgaggaggttgatgtcctgaaccgctacttcggccacc tgaagtctggtggcaatgcttatgtgatcggagacccagcgaagcctggc cagaagtggcacatctactatgccaccgagcaacctgagcagcccatggt caccctggagatgtgcatgactgggctggacaagaagaaggcctctgtct tcttcaagactcaagctgatggccacgtttcctgtgccaaggagatgacc aagctctctggaatctctgacattatccctgagatggaggtctgtgactt cgacttcgagccctgcggctactccatgaacgccatcaacggatctgccg tctccaccatccatgtgacccccgaggacggcttcagctacgcgagctac gaggtcatgggcatggacgcctccgccctggcctacggcgacatcgtcaa gagggtcctccggtgctttggcccttcagagttctctgtggcggtcacca tcttcggtggccgtggccacgccgccacctggggcaagaagctcgaagct gaggcatacgactgcaacaacgttgtggagcaggagctcccctgcggggg cgtcctcatctaccagagctttgccgcgaacgaagaggttgctgtctctg ccgggtcgcccaggtccgtcttccactgcttcnaggccganagtgtgcan agccaccctctggtcaaggaaggcaagctcgccaacctcctcncatggcg ggcggaggaggattccctggagganggcgcggtgctgtgcnantgattgg ctgtcnctgttcc
Download
page-top