Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715888
Length 754 bp
Fasta Format > whvd10b07
gcacgacgtggagtgcgcgccggagaaggaggtcgggagcctgagcgtgg agtggctggcggaggagaggaccaaggtcgtgggaacattccctcccaag aagaaaggatggaccggcctcgtcgagaaggacaccgccggccagaccaa catctactccatcgagccggcggtgtacgtggcggagagcgccatcagct ccggcacggcggggacgtcgtccgatgggtccgagaacacggcggcgctc acgggagggctggccctcatcttcgtcgccggggcggcctccatcctcat ccaggtgagcaagaaccagccgcccgtgcagacccaatactccggcccgc ctctcagctactacgtcgccaagttccagccggccgccgcggcattctcg gtccagtcgagcccccctgtcgtggaagcggccgcgcccgaggagacgcc ttctgaatctgattcacccaccttagaggcggaaacttcggcaaccgcgg agcagccgtcgtcgtgagctgataatcatatacacggtgagcgtgagacg gaaataatcgaagcataaatttgatgtggaagacaggcacgagcttttgt attancaattcnatacaacgctagagtttgaagagtttgacacgccgttc ttcactcatgagtgaagtctactctttattttgtacacgcggtctatgcc gggtggttcncttggtgttcanttacttatcttgcataccanttgcaatc atgt
Download
page-top