Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715887
Length 772 bp
Fasta Format > whvd10b06
cagctccgagtggctgggaggccacggcggaacgtgcgtgatacgtggct gcgtcccgaagaagatactcgtctacggggcatctttccggggggaattc gatgacgccaagcaattcgggtgggagatcaacggggacatcaactacaa ctggaaaaagttgctggaaaacaagactcaagagattgtgagattaaatg gagtgtacaagagaatccttggtggttctggtgtgaccatgattgaaggg gcaggaagtatagttgatgctcatactgtcgaagtcacccaaccagacgg ttcaaagcaaaggcacacgaccaagcacatattgattgcaactggtagcc gggcaactctggtcaacattcctggaaaggagctggctattacttcagat gaggctttaagtttggaggagctaccgaaacgcgccttgattcttggtgg cggatatattgctgttgaatttgcttcaatctggaaagggttgggtgctg aagtagatctattttataggaaagagcttcctctaagaggttttgatgat gagatgagaacagttgttgcaagtaaccttgagggaaggggaatcagatt gcatccggggaccaatttgactgagttgagtaaaacggccgatggcatta aagttgtgacagataaaggggatgagctcattgcanatgttgttcttttt gctacaggtcgtgcgccgaactccaataggctgaacttggaanctgttgg tgttgangttgatcaaatanga
Download
page-top