Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715879
Length 569 bp
Fasta Format > whvd10a18
gatcggtggccgccctgctcttgctactcgccatcgtcgtgccgtttact cagacccggacgcagagcgcacgggacaaggctgccatggcggaagacgc ggggccgttggtgggaggcatcaaggactcgccgatgggccaggagaacg acctcgacgtcatcgcgctcgcccgcttcgccgtctccgagcacaacaac aaggccaatgccctgctggagttcgagaatgtggtgaagctgaagaagca aactgttgctggcacgatgcactacattacaattcgggtcactgaaggtg gggccaagaagctctatgaagctaaggtgtgggagaaaccatgggagaac tttaagcagctccaggagttcaagccggtggaggacgctgcaatcgcatg aggcgcgccccagctttgcaaggatctgcagctatggtgttgatgcagct atcaatcggacatggtttagcgtgttctcgtgtaatatcaagaataagtc cgcttcttgcaagttgttttaaccacgtctctaaataaaattctctgcag tattattgcaaaaaaaaaa
Download
page-top