Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715877
Length 812 bp
Fasta Format > whvd10a16
cagaacctagtcaatcagaatggccgcaaccaccatgtcactctcttccc cagccttcgccggcaaggcagtgaagaacttgccatcatcatctcttttt ggggaggctcgcgtcaccatgcgcaagacggcggcaaaggccaagcaggt tacctctagtagcccgtggtacggctctgaccgcgtgctctacctgggcc cgctttctggtgagcccccgagctacctgaccggtgagttccccggcgac tacgggtgggacaccgctggtctgtcggctgaccccgagaccttcgccaa gaaccgggaactcgaggtgatccactgccgttgggccatgcttggcgcgc tcggttgcatcttccccgagctactcgcccgcaacggcgttaagtttggt gaggctgtttggttcaaggccggatcccagatcttcagcgagggcggcct tgactacctcggcaacccaagccttgtgcacgcgcaaagtatccttgcca tttgggcttgccaggtcgtgctcatgggcgccgtcgagggctaccgcgtt gccggtggaccactcggtgagatcgtcgacccactctacccgggcggcag ttttgatccgcttggccttgccgacgaccctgaggcattcgccgagctta aggttaangagatcaagaacggtcgcctcgccatgttctccatgttcggc ttcttcntgcaagccatcgtcaccggcaagggtccactcnanaacctcnc tgaccaccttgccnaccccgtcaacaacaatgcctgggcatttgccacca acttcnttcctg
Download
page-top