Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715873
Length 811 bp
Fasta Format > whvd10a11
ctgccaatggctgggtgcaatcttatggatccaggtgcgtcaagccaccg attatctatggtgacgtgagccgccccaaccccatgactgtgttctggtc caagatggcacagagcatgactgctcgcccaatgaagggaatgttgacag gccctgtcacaatccttaactggtcttttgtcagaaatgaccaaccgagg tttgagacttgctaccagattgctcttgcaatcaagaaggaggttgagga tcttgaggcaggcggtattcaggtcatccaaattgacgaggctgctttga gagagggtctgccactccgcaagtctgagcacgctttctacttggactgg gccgtgcactccttcaggatcaccaactgcggtgtccaggacaccaccca gatccacacccacatgtgctactccaacttcaacgacatcatccagtcca tcatcaacatggacgctgatgtgatcaccattgagaactcgcggtctgac gagaagcttctctccgtcttccgcgagggtgtggtgtacggtgcaggcat tggcccgggtgtgtacgacatccactcccccaggatcccgtccaaggagg agattgccgaccgtgtcaacaagatgctcgcggtgctcgacaccaacatc ctgtgggtgaaccctgactgcggtctcaagacccgcaagtacgccgaggt caagcctgcgctcaccaacatggttgaggccgccaagcanatccgcgccg agctcgccaaggcgcantaagccgtgcttgtatancanctccccactttt aattgcaagga
Download
page-top