Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715870
Length 467 bp
Fasta Format > whvd10a05
gtctaccgctgaggcaacccgtgaggagaatgtgtacatggccaagctcg ccgagcaggctgancgttacgaggaaatggttgagttcatggagaaggtc gcaaagaccgctgatgttggtgagctcactgttgaggagcgcaacctgct ctctgtggcttacaanaatgtgattggtgcccngagggcttcctggagga tcatctcctccattgagcagaaggaggagagccgtgggaacgaggcctat gttgcttcaatcaaggagtaccgtaccaggattgaaaccgagctcagcaa gatctgtgatggcatcctcaagcttctggactcccaccttgtcccctctg ccactgcagcagagtccaaggtgttctatctgaaaatgaagggtgactac cacaggtaccttgcggagttcaaggcgggtgctganaggaaagaagcanc tgagaacactcttgtag
Download
page-top